yojI

Information for yojI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2303128-2304774 - CDS yojH EG12069 orf; hypothetical protein 2304992-2306635 - CDS yojI EG12070 putative ATP-binding component of a transport system 2306711-2307361 - CDS alkB EG10037 DNA repair system specific for alkylated DNA

Reported regulatory sites for yojI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.275 2306690-2306713 R aagaa TAAAAATAAGAATTATTATTGCTG tgcgc - 0 - 1.279 2306655-2306674 R gatgt TTAAACTGCGGGCTGTAATT cattg - 0 - 0.596 2306666-2306688 R gctgt GCGCGCGAAGATGTTTAAACTGC gggct - 0 -

Critical MAP values: p=0.01 4.76 p=0.05 3.70 p=0.1 3.23 p=0.2 2.71

Click here to go back