yqcD

Information for yqcD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2922757-2923302 - CDS syd EG12959 interacts with secY 2923370-2924218 + CDS yqcD EG13173 orf; hypothetical protein 2924330-2925694 + CDS ygdH EG12373 orf; hypothetical protein

Reported regulatory sites for yqcD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.634 2923327-2923350 aacca GATACACTTGTCGTTTAGTTTATC tggtt - 0 - 1.642 2923353-2923369 atctg GTTTATGACGGTGAAAC atgtc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back