yrfE

Information for yrfE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3520485-3523061 + CDS mrcA EG10748 peptidoglycan synthetase; penicillin-binding protein 1A 3523227-3523787 - CDS yrfE EG12926 orf; hypothetical protein 3524107-3526242 + CDS yrfF EG12927 putative dehydrogenase

Reported regulatory sites for yrfE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.814 3523905-3523928 R gagtt ATTTCAACCTATTGACTTTTAATT tgatt - 0 - 2.814 3523847-3523870 R cataa ATGTAAATAACATGCAATTCACAT tgccg - 0 - 2.498 3523935-3523954 R gaagg CGGAATATCAGCAAATTCCT ggagt - 0 - 1.705 3524020-3524043 R gattc TGCGGTTGGCTATCGGCAAGCGTG gagtt - 0 - 1.705 3523992-3524015 R ggagt TTAACTTGAGCATCATTAAGCACA tcaca - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back