ysgA

Information for ysgA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4010643-4012904 + CDS metE EG10584 tetrahydropteroyltriglutamate methyltransferase 4012721-4013719 - CDS ysgA EG14321 putative enzyme 4014018-4014779 + CDS udp EG11045 uridine phosphorylase

Reported regulatory sites for ysgA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.581 4013925-4013948 R acatt TTTTCGTGATACTCATCACCATGA cgcaa crp 19 - 5.581 4013873-4013896 R cccac CAAAAGTGATGCAAATCACATAAA tcacc crp 19 - 4.122 4013791-4013810 R gttgc ATGCTGACTATAGTTAACAT tgcgc - 0 - 3.190 4013965-4013981 R aagaa GCAAAAAGACACTTTAC cgaag - 0 - 3.190 4013811-4013827 R ttcag GCAATGTGATTTGTTGC atgct - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back