ytfF
 
Information for ytfF, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
4428899-4429561
-
CDS
orf; hypothetical protein
4429669-4430643
-
CDS
ytfF
putative transmembrane subunit
4430742-4431602
-
CDS
putative oxidoreductase
 
Reported regulatory sites for ytfF:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.213
4430697-4430713 R
catcc TCTCTGATAATGACGGG atgcc
-
0
-
1.203
4430670-4430691 R
atgcc GGGAGCAATCATGTCTGCTTCC tgaac
-
0
-
-
0.765
4430648-4430669 R
cttcc TGAACTTTCTTCTGACAGATCA atgga
-
0
-
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back