ytfJ
 
Information for ytfJ, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
4435285-4435785
+
CDS
orf; hypothetical protein
4436285-4436839
-
CDS
ytfJ
orf; hypothetical protein
4437125-4437370
+
CDS
orf; hypothetical protein
 
Reported regulatory sites for ytfJ:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: HI ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
4.391
4436863-4436879 R
gaccc AAGTGGTCGGATCACCT gcata
-
0
-
2.430
4437077-4437094 R
aaatt TTAATGCTTAGTGACTAT agact
-
0
-
2.430
4437007-4437024 R
aggtt ACAATTATTCAGAATTAT ctttt
-
0
-
2.065
4436921-4436943 R
ttgac CGCAAACTGGCATCACACTTGCG ggaaa
-
0
-
 
Critical MAP values:
p=0.01
6.03
p=0.05
4.63
p=0.1
3.98
p=0.2
3.37

Click here to go back