ytfJ

Information for ytfJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4435285-4435785 + CDS ytfI EG12509 orf; hypothetical protein 4436285-4436839 - CDS ytfJ EG12510 orf; hypothetical protein 4437125-4437370 + CDS ytfK EG12511 orf; hypothetical protein

Reported regulatory sites for ytfJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.391 4436863-4436879 R gaccc AAGTGGTCGGATCACCT gcata - 0 - 2.430 4437077-4437094 R aaatt TTAATGCTTAGTGACTAT agact - 0 - 2.430 4437007-4437024 R aggtt ACAATTATTCAGAATTAT ctttt - 0 - 2.065 4436921-4436943 R ttgac CGCAAACTGGCATCACACTTGCG ggaaa - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back