ytfR
 
Information for ytfR, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
4447539-4448495
+
CDS
putative LACI-type transcriptional regulator
4448633-4449886
+
CDS
ytfR
putative ATP-binding component of a transport system
4449862-4450134
+
CDS
putative ATP-binding component of a transport system
 
Reported regulatory sites for ytfR:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: HI EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
1.505
4448548-4448571
cgcat CCGGCGATGGTGCACTGAAGCCTG atgcg
-
0
REP336a (5) REP336b (5)
0.750
4448615-4448630
cacgc TTTACACCGGGGGAAA ccatg
-
0
-
 
Critical MAP values:
p=0.01
4.11
p=0.05
2.92
p=0.1
2.48
p=0.2
2.01

Click here to go back