zipA

Information for zipA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2526181-2528196 - CDS lig EG10534 DNA ligase 2528267-2529253 - CDS zipA EG14169 cell division protein involved in FtsZ ring 2529483-2530244 + CDS cysZ EG10003 required for sulfate transport

Reported regulatory sites for zipA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.640 2529277-2529293 R aaatg TTTGCCGTGGTGGCAAG gtgtt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.021 2529361-2529384 R acagc AAAAAGCACGATTTCATCTATCTT tgtgc - 0 - 2.436 2529310-2529333 R cactt GCACTTGAGGTAATCGGCAAATAC tctta - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back