zwf

Information for zwf, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1930817-1932628 - CDS edd EG10257 6-phosphogluconate dehydratase 1932863-1934338 - CDS zwf EG11221 glucose-6-phosphate dehydrogenase 1934676-1935545 + CDS yebK EG12860 orf; hypothetical protein

Reported regulatory sites for zwf: Genome coordinates Source Transcription factor Transcription factor annotation 1934431-1934465 DPInteract soxS regulation of superoxide response regulon

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.152 1934546-1934562 R aaaag TTGTTATTTTTTTTCAT aacat - 0 - 3.152 1934386-1934402 R gtgca CCGTAAGAAAATTACAA gtata - 0 - 2.011 1934626-1934649 R aatga CGATTTCCGCACTGAAAGAAATCG aaatg - 0 - 2.011 1934413-1934436 R tttac AGTTTTCGCAAGCTCGTAAAAGCA gtaca soxS 6 - 1.800 1934493-1934516 R cccaa TGGAAAACGATGATTTTTTTATCA gtttt - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back