aas Gene Page

Repeat: PAIR2b     Overlap: 18
Repeat: aas_galR_IR3     Overlap: 18
Solution location in genomic coordinates: 2974132-2974149 R
Solution sequence with flanking nucleotides: accaa CCTGCGCGGATGCGCAGG ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: PAIR2a     Overlap: 18
Repeat: aas_galR_IR1     Overlap: 18

---

Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 12.62
Model logo: aas.2.model.LGO.gif
Sequence logo: aas.2.LGO.gif
Sequence Alignment: aas.2.ALGN
Solution location in genomic coordinates: 2974387-2974408 R
Solution sequence with flanking nucleotides: ggtga TCCCAGAGGTATTGATAGGTGA agtca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: PAIR2b     Overlap: 22
Solution location in genomic coordinates: 2974191-2974212 R
Solution sequence with flanking nucleotides: caaga TCCCAGAGGTATTGATTGGTGA gatta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: PAIR2a     Overlap: 22
Repeat: aas_galR_IR2     Overlap: 18

---

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 7.87
Model logo: aas.3.model.LGO.gif
Sequence logo: aas.3.LGO.gif
Sequence Alignment: aas.3.ALGN
Solution location in genomic coordinates: 2974463-2974482 R
Solution sequence with flanking nucleotides: aaacc TTTGGTTACACTTTGCGAAA cgctg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2974416-2974435 R
Solution sequence with flanking nucleotides: tggcg TTTGGCTTCAGGTTGCTAAA gtggt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: PAIR2b     Overlap: 20


Gene Index Page