abc Gene Page
Genbank name: abc
EcoGene name: abc
Divergent gene: yaeD
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG11621
Species that contributed to the solution: AA EC HI ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 36.91
Model logo: abc.1.model.LGO.gif
Sequence logo: abc.1.LGO.gif
Sequence Alignment: abc.1.ALGN
Solution location in genomic coordinates: 222732-222747 R
Solution sequence with flanking nucleotides: gattg ATTTAGACGTCTGGAT gcctt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 18.58
Model logo: abc.2.model.LGO.gif
Sequence logo: abc.2.LGO.gif
Sequence Alignment: abc.2.ALGN
Solution location in genomic coordinates: 222812-222832 R
Solution sequence with flanking nucleotides: CTTTTATAGCTCCTTAATAAG gcatg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 222648-222668 R
Solution sequence with flanking nucleotides: ctaac TTAATGACGATAATAAATAAT ca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 16.31
Model logo: abc.3.model.LGO.gif
Sequence logo: abc.3.LGO.gif
Sequence Alignment: abc.3.ALGN
Solution location in genomic coordinates: 222725-222747 R
Solution sequence with flanking nucleotides: gattg ATTTAGACGTCTGGATGCCTTAA catcc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 222674-222696 R
Solution sequence with flanking nucleotides: cccgt TTCAGGCATTCGAGATGCCACGA ctaac
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page