abrB Gene Page
Genbank name: abrB
EcoGene name: abrB
Divergent gene:
Species with an ortholog:
EC ST
EcoGene link: EG13310
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 2.94
Model logo: abrB.1.model.LGO.gif
Sequence logo: abrB.1.LGO.gif
Sequence Alignment: abrB.1.ALGN
Solution location in genomic coordinates: 747100-747120 R
Solution sequence with flanking nucleotides: gccgc CGGAAAGGGCATCTCTTTCAG aaaat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page