accB Gene Page
Genbank name: accB
EcoGene name: accB
Divergent gene: b3254
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10275
Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 1
Map value: 35.68
Model logo: accB.1.model.LGO.gif
Sequence logo: accB.1.LGO.gif
Sequence Alignment: accB.1.ALGN
Solution location in genomic coordinates: 3402778-3402797
Solution sequence with flanking nucleotides: gctgc CAATTGCTACGAAATCGTTA taatg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 12
Number of E. coli sites in the solution: 1
Map value: 32.32
Model logo: accB.2.model.LGO.gif
Sequence logo: accB.2.LGO.gif
Sequence Alignment: accB.2.ALGN
Solution location in genomic coordinates: 3402578-3402601
Solution sequence with flanking nucleotides: ttgtg GTCTGTGAAGATTATCTCATTGCA gcccc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 26.38
Model logo: accB.3.model.LGO.gif
Sequence logo: accB.3.LGO.gif
Sequence Alignment: accB.3.ALGN
Solution location in genomic coordinates: 3403010-3403029
Solution sequence with flanking nucleotides: atacg CTTTACAGACGGCGGTGAAA cgcct
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page