accD Gene Page

Solution location in genomic coordinates: 2431995-2432018 R
Solution sequence with flanking nucleotides: gttgg GGGCAAAAATGGCATTATGCGTCC ccaaa
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 25.60
Model logo: accD.2.model.LGO.gif
Sequence logo: accD.2.LGO.gif
Sequence Alignment: accD.2.ALGN
Solution location in genomic coordinates: 2432060-2432081 R
Solution sequence with flanking nucleotides: ttcga CCACTTTTTTATCCAAAGTTTC gggct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2432007-2432028 R
Solution sequence with flanking nucleotides: ttcat GGTCTGTTGGGGGCAAAAATGG catta
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 25.23
Model logo: accD.3.model.LGO.gif
Sequence logo: accD.3.LGO.gif
Sequence Alignment: accD.3.ALGN
Solution location in genomic coordinates: 2432060-2432081 R
Solution sequence with flanking nucleotides: ttcga CCACTTTTTTATCCAAAGTTTC gggct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2431950-2431971 R
Solution sequence with flanking nucleotides: tcgaa CCAGGTTCAGACAGAAAGGTCC cta
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page