aceB Gene Page

Genbank name: aceB
EcoGene name: aceB
Divergent gene:
Species with an ortholog: EC   SP   ST   VC   YP   
EcoGene link: EG10023
   Reported site,genomic coordinates and site type: DPInteract 4212807:4212822 fruR
   Reported site,genomic coordinates and site type: DPInteract 4212936:4212950 iclR

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 27.23
Model logo: aceB.1.model.LGO.gif
Sequence logo: aceB.1.LGO.gif
Sequence Alignment: aceB.1.ALGN
Solution location in genomic coordinates: 4212882-4212905
Solution sequence with flanking nucleotides: aggtg AATAAATTTTATTCATATTGTTAT caaca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: metA_aceB_IR     Overlap: 24
Solution location in genomic coordinates: 4212929-4212952
Solution sequence with flanking nucleotides: tttta ATTAAAATGGAAATTGTTTTTGAT tttgc
Number of overlapping basepairs with reported site: 15
Site type: iclR
Repeat: metA_aceB_IR     Overlap: 24

Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 26.89
Model logo: aceB.2.model.LGO.gif
Sequence logo: aceB.2.LGO.gif
Sequence Alignment: aceB.2.ALGN
Solution location in genomic coordinates: 4212923-4212941
Solution sequence with flanking nucleotides: aagta TTTTTAATTAAAATGGAAA ttgtt
Number of overlapping basepairs with reported site: 6
Site type: iclR
Repeat: metA_aceB_IR     Overlap: 19
Solution location in genomic coordinates: 4212953-4212971
Solution sequence with flanking nucleotides: ttgat TTTGCATTTTAAATGAGTA gtctt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: metA_aceB_IR     Overlap: 19

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 15.00
Model logo: aceB.3.model.LGO.gif
Sequence logo: aceB.3.LGO.gif
Sequence Alignment: aceB.3.ALGN
Solution location in genomic coordinates: 4212830-4212853
Solution sequence with flanking nucleotides: cttac CTCAGGCACCTTCGGGTGCCTTTT ttatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4212998-4213021
Solution sequence with flanking nucleotides: aagag CACAACGATCCTTCGTTCACAGTG gggaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: metA_aceB_IR     Overlap: 24


Gene Index Page