aceE Gene Page

Genbank name: aceE
EcoGene name: aceE
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST VC YP
EcoGene link: EG10024

Species that contributed to the solution: AA EC HI PA ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 16.22
Model logo: aceE.1.model.LGO.gif
Sequence logo: aceE.1.LGO.gif
Sequence Alignment: aceE.1.ALGN
Solution location in genomic coordinates: 122856-122879
Solution sequence with flanking nucleotides: ta GTGATTTTTCTGGTAAAAATTATC cagaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 122991-123014
Solution sequence with flanking nucleotides: tcaac GTTATTAGATAGATAAGGAATAAC cc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA ST VC
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 15.88
Model logo: aceE.2.model.LGO.gif
Sequence logo: aceE.2.LGO.gif
Sequence Alignment: aceE.2.ALGN
Solution location in genomic coordinates: 122925-122944
Solution sequence with flanking nucleotides: actaa ACGTAGAACCTGTCTTATTG agctt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: pdhR_aceE_IR Overlap: 15
Solution location in genomic coordinates: 122963-122982
Solution sequence with flanking nucleotides: gagtt CAATGGGACAGGTTCCAGAA aactc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: pdhR_aceE_IR Overlap: 15

Species that contributed to the solution: AA EC HI PA
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 6.92
Model logo: aceE.3.model.LGO.gif
Sequence logo: aceE.3.LGO.gif
Sequence Alignment: aceE.3.ALGN
Solution location in genomic coordinates: 122884-122901
Solution sequence with flanking nucleotides: ccaga AGATGTTGTAAATCAAGC gcata
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page