ackA Gene Page
Genbank name: ackA
EcoGene name: ackA
Divergent gene: yfbV
Species with an ortholog:
EC HI PA SP ST VC YP
EcoGene link: EG10027
Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 28.37
Model logo: ackA.1.model.LGO.gif
Sequence logo: ackA.1.LGO.gif
Sequence Alignment: ackA.1.ALGN
Solution location in genomic coordinates: 2411173-2411192
Solution sequence with flanking nucleotides: cacat ATAAAGATTCAAAAATTTGT gcaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2411213-2411232
Solution sequence with flanking nucleotides: agcgg GACAACGTTCAAAACATTTT gtctt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI PA ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 24.25
Model logo: ackA.2.model.LGO.gif
Sequence logo: ackA.2.LGO.gif
Sequence Alignment: ackA.2.ALGN
Solution location in genomic coordinates: 2411399-2411419
Solution sequence with flanking nucleotides: gtgca TGATGTTAATCATAAATGTCG gtgtc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfbV_ackA_IR     Overlap: 21
Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 12
Number of E. coli sites in the solution: 2
Map value: 23.16
Model logo: ackA.3.model.LGO.gif
Sequence logo: ackA.3.LGO.gif
Sequence Alignment: ackA.3.ALGN
Solution location in genomic coordinates: 2411175-2411190
Solution sequence with flanking nucleotides: catat AAAGATTCAAAAATTT gtgca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2411397-2411412
Solution sequence with flanking nucleotides: cagtg CATGATGTTAATCATA aatgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfbV_ackA_IR     Overlap: 16
Gene Index Page