acnA Gene Page

Genbank name: acnA
EcoGene name: acnA
Divergent gene:
Species with an ortholog: EC PA SP ST VC YP
EcoGene link: EG11325

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 12.59
Model logo: acnA.1.model.LGO.gif
Sequence logo: acnA.1.LGO.gif
Sequence Alignment: acnA.1.ALGN
Solution location in genomic coordinates: 1333463-1333486
Solution sequence with flanking nucleotides: tgaag ATGATCAGCCGAAACAATAATTAT catca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1333596-1333619
Solution sequence with flanking nucleotides: agcct ATGATCAACACAAATATGAAATAT tggtc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 11.08
Model logo: acnA.2.model.LGO.gif
Sequence logo: acnA.2.LGO.gif
Sequence Alignment: acnA.2.ALGN
Solution location in genomic coordinates: 1333483-1333503
Solution sequence with flanking nucleotides: aataa TTATCATCATTCTTATTACCC atttt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1333789-1333809
Solution sequence with flanking nucleotides: tgttt GTGTTATCTTTAATATTCACC ctgaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 10.49
Model logo: acnA.3.model.LGO.gif
Sequence logo: acnA.3.LGO.gif
Sequence Alignment: acnA.3.ALGN
Solution location in genomic coordinates: 1333747-1333770
Solution sequence with flanking nucleotides: tcctc TTTTATCAATTTGGGTTGTTATCA aatcg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page