acnB Gene Page

Genbank name: acnB
EcoGene name: acnB
Divergent gene: yacH
Species with an ortholog: EC   PA   SP   ST   VC   YP   
EcoGene link: EG12316

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 13.20
Model logo: acnB.1.model.LGO.gif
Sequence logo: acnB.1.LGO.gif
Sequence Alignment: acnB.1.ALGN
Solution location in genomic coordinates: 131494-131515
Solution sequence with flanking nucleotides: acctc GTCAAAATCCTGCTATTCTGCC cgttg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 12.77
Model logo: acnB.2.model.LGO.gif
Sequence logo: acnB.2.LGO.gif
Sequence Alignment: acnB.2.ALGN
Solution location in genomic coordinates: 131342-131364
Solution sequence with flanking nucleotides: ggtag TTTAAATTTTGACTAATCTTGGG attcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 131440-131462
Solution sequence with flanking nucleotides: catcc TTAACGATTCAGCCACTTTTTTA tgttg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.77
Model logo: acnB.3.model.LGO.gif
Sequence logo: acnB.3.LGO.gif
Sequence Alignment: acnB.3.ALGN
Solution location in genomic coordinates: 131466-131489
Solution sequence with flanking nucleotides: tatgt TGCTTTTTTGTAAACAGATTAACA cctcg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page