acpD Gene Page

Genbank name: acpD
EcoGene name: acpD
Divergent gene: hrpA
Species with an ortholog: AA   EC   HI   PA   SP   ST   YP   
EcoGene link: EG12695

Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 23.33
Model logo: acpD.1.model.LGO.gif
Sequence logo: acpD.1.LGO.gif
Sequence Alignment: acpD.1.ALGN
Solution location in genomic coordinates: 1480983-1481003 R
Solution sequence with flanking nucleotides: atgcg TTGTTCAATAAATTCGAACAT aggct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1480927-1480947 R
Solution sequence with flanking nucleotides: cagga TTGTGAATAAAGTGTCAACAA gcaac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 18.67
Model logo: acpD.2.model.LGO.gif
Sequence logo: acpD.2.LGO.gif
Sequence Alignment: acpD.2.ALGN
Solution location in genomic coordinates: 1481010-1481033 R
Solution sequence with flanking nucleotides: tagat ATAGAGTACCACATCGCGGCTTTC tatgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1480961-1480984 R
Solution sequence with flanking nucleotides: cgaac ATAGGCTTCGATTTATTGCGCTAT ctctg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 10.01
Model logo: acpD.3.model.LGO.gif
Sequence logo: acpD.3.LGO.gif
Sequence Alignment: acpD.3.ALGN
Solution location in genomic coordinates: 1481039-1481060 R
Solution sequence with flanking nucleotides: ctgcc TGATTAATTTTCTTTTAAATGA tagat
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page