acpP Gene Page

Genbank name: acpP
EcoGene name: acpP
Divergent gene:
Species with an ortholog: EC   HI   PA   SP   TF   VC   YP   
EcoGene link: EG50003

Species that contributed to the solution: EC HI SP TF VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 18.34
Model logo: acpP.1.model.LGO.gif
Sequence logo: acpP.1.LGO.gif
Sequence Alignment: acpP.1.ALGN
Solution location in genomic coordinates: 1150631-1150648
Solution sequence with flanking nucleotides: gaccg CGATTTGCACAAAATGCT catgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1150778-1150795
Solution sequence with flanking nucleotides: ttttc AACATTTTATACACTACG aaaac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP TF YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 16.12
Model logo: acpP.2.model.LGO.gif
Sequence logo: acpP.2.LGO.gif
Sequence Alignment: acpP.2.ALGN
Solution location in genomic coordinates: 1150797-1150820
Solution sequence with flanking nucleotides: tacga AAACCATCGCGAAAGCGAGTTTTG atagg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP TF VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 16.09
Model logo: acpP.3.model.LGO.gif
Sequence logo: acpP.3.LGO.gif
Sequence Alignment: acpP.3.ALGN
Solution location in genomic coordinates: 1150739-1150755
Solution sequence with flanking nucleotides: taaaa TCGTGGTAAGACCTGCC gggat
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page