acrA Gene Page
Genbank name: acrA
EcoGene name: acrA
Divergent gene: acrR
Species with an ortholog:
EC ST YP
EcoGene link: EG11703
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 38.84
Model logo: acrA.1.model.LGO.gif
Sequence logo: acrA.1.LGO.gif
Sequence Alignment: acrA.1.ALGN
Solution location in genomic coordinates: 484936-484957 R
Solution sequence with flanking nucleotides: tagat TTACATACATTTGTGAATGTAT gtacc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: acrA_acrR_IR     Overlap: 21
Solution location in genomic coordinates: 484893-484914 R
Solution sequence with flanking nucleotides: ataat ATAAACGCAGCAATGGGTTTAT taact
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 26.38
Model logo: acrA.2.model.LGO.gif
Sequence logo: acrA.2.LGO.gif
Sequence Alignment: acrA.2.ALGN
Solution location in genomic coordinates: 484894-484913 R
Solution sequence with flanking nucleotides: taata TAAACGCAGCAATGGGTTTA ttaac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 484848-484867 R
Solution sequence with flanking nucleotides: atttg AAATCGGACACTCGAGGTTT acat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 23.96
Model logo: acrA.3.model.LGO.gif
Sequence logo: acrA.3.LGO.gif
Sequence Alignment: acrA.3.ALGN
Solution location in genomic coordinates: 484963-484984 R
Solution sequence with flanking nucleotides: ATGTTCGTGAATTTACAGGCGT tagat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 484869-484890 R
Solution sequence with flanking nucleotides: tatta ACTTTTGACCATTGACCAATTT gaaat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page