acrD Gene Page
Genbank name: acrD
EcoGene name: acrD
Divergent gene:
Species with an ortholog:
EC PA SP ST YP
EcoGene link: EG10014
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.62
Model logo: acrD.1.model.LGO.gif
Sequence logo: acrD.1.LGO.gif
Sequence Alignment: acrD.1.ALGN
Solution location in genomic coordinates: 2585506-2585521
Solution sequence with flanking nucleotides: ggcat GATAATTTACATTAAC tcctt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA SP ST
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 10.13
Model logo: acrD.2.model.LGO.gif
Sequence logo: acrD.2.LGO.gif
Sequence Alignment: acrD.2.ALGN
Solution location in genomic coordinates: 2585475-2585492
Solution sequence with flanking nucleotides: gaata CTTGCACTTAAGGTTCAG tataa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2585551-2585568
Solution sequence with flanking nucleotides: cgtac CTTGCCGCTACAGTGAAG caagt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA SP ST
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 7.75
Model logo: acrD.3.model.LGO.gif
Sequence logo: acrD.3.LGO.gif
Sequence Alignment: acrD.3.ALGN
Solution location in genomic coordinates: 2585472-2585495
Solution sequence with flanking nucleotides: aaaga ATACTTGCACTTAAGGTTCAGTAT aaaag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2585589-2585612
Solution sequence with flanking nucleotides: acgat ACGCAGAAACACGAGGTCCTCTTT ta
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page