acrR Gene Page

Genbank name: acrR
EcoGene name: acrR
Divergent gene: acrA
Species with an ortholog: EC   ST   YP   
EcoGene link: EG12116

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 40.46
Model logo: acrR.1.model.LGO.gif
Sequence logo: acrR.1.LGO.gif
Sequence Alignment: acrR.1.ALGN
Solution location in genomic coordinates: 484893-484914
Solution sequence with flanking nucleotides: agtta ATAAACCCATTGCTGCGTTTAT attat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 484936-484957
Solution sequence with flanking nucleotides: ggtac ATACATTCACAAATGTATGTAA atcta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: acrA_acrR_IR     Overlap: 21

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 20.57
Model logo: acrR.2.model.LGO.gif
Sequence logo: acrR.2.LGO.gif
Sequence Alignment: acrR.2.ALGN
Solution location in genomic coordinates: 484869-484890
Solution sequence with flanking nucleotides: atttc AAATTGGTCAATGGTCAAAAGT taata
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 484963-484984
Solution sequence with flanking nucleotides: atcta ACGCCTGTAAATTCACGAACAT
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 19.88
Model logo: acrR.3.model.LGO.gif
Sequence logo: acrR.3.LGO.gif
Sequence Alignment: acrR.3.ALGN
Solution location in genomic coordinates: 484847-484868
Solution sequence with flanking nucleotides: atg TAAACCTCGAGTGTCCGATTTC aaatt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page