acs Gene Page
Genbank name: acs
EcoGene name: acs
Divergent gene: nrfA
Species with an ortholog:
EC PA SP ST TF VC YP
EcoGene link: EG11448
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 21.12
Model logo: acs.1.model.LGO.gif
Sequence logo: acs.1.LGO.gif
Sequence Alignment: acs.1.ALGN
Solution location in genomic coordinates: 4285176-4285198 R
Solution sequence with flanking nucleotides: aattg TAAGTGCATGTAAAATACCACTT tagag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4284975-4284997 R
Solution sequence with flanking nucleotides: cattt AACGCTTATGCCACATATTATTA acatc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.71
Model logo: acs.2.model.LGO.gif
Sequence logo: acs.2.LGO.gif
Sequence Alignment: acs.2.ALGN
Solution location in genomic coordinates: 4285030-4285051 R
Solution sequence with flanking nucleotides: ctact TTTGCGTGATCTGTCGCCCAAA tacta
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 11.33
Model logo: acs.3.model.LGO.gif
Sequence logo: acs.3.LGO.gif
Sequence Alignment: acs.3.ALGN
Solution location in genomic coordinates: 4285225-4285241 R
Solution sequence with flanking nucleotides: ctatg TGTAACAAATAACCACA ctgtg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4284973-4284989 R
Solution sequence with flanking nucleotides: gctta TGCCACATATTATTAAC atcct
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page