ada Gene Page

Genbank name: ada
EcoGene name: ada
Divergent gene:
Species with an ortholog: EC   PA   ST   YP
EcoGene link: EG10029    Reported site,genomic coordinates and site type: DPInteract 2308485:2308515 ada
   Reported site,genomic coordinates and site type: RegulonDB 2308475:2308502 ada

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 21.82
Model logo: ada.1.model.LGO.gif
Sequence logo: ada.1.LGO.gif
Sequence Alignment: ada.1.ALGN
Solution location in genomic coordinates: 2308475-2308496 R
Solution sequence with flanking nucleotides: taaag CGCAAGATTGTTGGTTTTTGCG tgatg
Number of overlapping basepairs with reported site: 22
Site type: ada ada

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.68
Model logo: ada.2.model.LGO.gif
Sequence logo: ada.2.LGO.gif
Sequence Alignment: ada.2.ALGN
Solution location in genomic coordinates: 2308426-2308441 R
Solution sequence with flanking nucleotides: tcctt AACCAGGGAGCTGATT
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.05
Model logo: ada.3.model.LGO.gif
Sequence logo: ada.3.LGO.gif
Sequence Alignment: ada.3.ALGN
Solution location in genomic coordinates: 2308444-2308463 R
Solution sequence with flanking nucleotides: tgacc GGGCAGCCTAAAGGCTATCC ttaac
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page