add Gene Page

Genbank name: add
EcoGene name: add
Divergent gene:
Species with an ortholog: EC PA SP ST TF VC
EcoGene link: EG10030

Species that contributed to the solution: EC ST TF
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 11.39
Model logo: add.1.model.LGO.gif
Sequence logo: add.1.LGO.gif
Sequence Alignment: add.1.ALGN
Solution location in genomic coordinates: 1700216-1700235
Solution sequence with flanking nucleotides: ttttt ATAATGGTGCGCACTTTTAT atcca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST TF
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 5.53
Model logo: add.2.model.LGO.gif
Sequence logo: add.2.LGO.gif
Sequence Alignment: add.2.ALGN
Solution location in genomic coordinates: 1700151-1700168
Solution sequence with flanking nucleotides: TAACCCCAATTGCGCAAC gtaaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: malY_add_IR Overlap: 15

Species that contributed to the solution: EC SP ST TF VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 5.08
Model logo: add.3.model.LGO.gif
Sequence logo: add.3.LGO.gif
Sequence Alignment: add.3.ALGN
Solution location in genomic coordinates: 1700171-1700192
Solution sequence with flanking nucleotides: aacgt AAAAAATCGTTGCGCAATCGTG gattt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: malY_add_IR Overlap: 22

Gene Index Page