adhE Gene Page

Solution location in genomic coordinates: 1297360-1297379 R
Solution sequence with flanking nucleotides: atgat TTACTAAAAAAGTTTAACAT tatca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: adhE_ychE_IR1     Overlap: 20

---

Species that contributed to the solution: AA EC ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 32.16
Model logo: adhE.2.model.LGO.gif
Sequence logo: adhE.2.LGO.gif
Sequence Alignment: adhE.2.ALGN
Solution location in genomic coordinates: 1297474-1297496 R
Solution sequence with flanking nucleotides: actct AATGTTTAAACTCTTTTAGTAAA tcaca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: adhE_ychE_IR1     Overlap: 23
Repeat: adhE_ychE_IR2     Overlap: 4
Solution location in genomic coordinates: 1297358-1297380 R
Solution sequence with flanking nucleotides: gatga TTTACTAAAAAAGTTTAACATTA tcagg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: adhE_ychE_IR1     Overlap: 23

---

Species that contributed to the solution: AA EC ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 17.67
Model logo: adhE.3.model.LGO.gif
Sequence logo: adhE.3.LGO.gif
Sequence Alignment: adhE.3.ALGN
Solution location in genomic coordinates: 1297564-1297585 R
Solution sequence with flanking nucleotides: tgcaa AAATTTGATTTGGATCACGTAA tcagt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page