adhP Gene Page
Genbank name: adhP
EcoGene name: adhP
Divergent gene:
Species with an ortholog:
EC PA ST
EcoGene link: EG12622
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 8.39
Model logo: adhP.1.model.LGO.gif
Sequence logo: adhP.1.LGO.gif
Sequence Alignment: adhP.1.ALGN
Solution location in genomic coordinates: 1551967-1551988 R
Solution sequence with flanking nucleotides: ctgcg CCCGGTAGTGAAGGCTACCGGG ctatt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.93
Model logo: adhP.2.model.LGO.gif
Sequence logo: adhP.2.LGO.gif
Sequence Alignment: adhP.2.ALGN
Solution location in genomic coordinates: 1551901-1551923 R
Solution sequence with flanking nucleotides: ggtag TGGCGAATAAATCTCATTTGCCT cacct
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.71
Model logo: adhP.3.model.LGO.gif
Sequence logo: adhP.3.LGO.gif
Sequence Alignment: adhP.3.ALGN
Solution location in genomic coordinates: 1551932-1551951 R
Solution sequence with flanking nucleotides: ctccc TTTTTCAGATCTCATCCATA ctggg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page