adiA Gene Page

Genbank name: adiA
EcoGene name: adiA
Divergent gene:
Species with an ortholog: EC   PA   ST   YP   
EcoGene link: EG11501

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.31
Model logo: adiA.1.model.LGO.gif
Sequence logo: adiA.1.LGO.gif
Sequence Alignment: adiA.1.ALGN
Solution location in genomic coordinates: 4338199-4338215 R
Solution sequence with flanking nucleotides: aacgt ATTGTTTATAAAACTAA atatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 5.02
Model logo: adiA.2.model.LGO.gif
Sequence logo: adiA.2.LGO.gif
Sequence Alignment: adiA.2.ALGN
Solution location in genomic coordinates: 4338219-4338239 R
Solution sequence with flanking nucleotides: gaaaa TAATTTAAAATAATCACATAA cgtat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.99
Model logo: adiA.3.model.LGO.gif
Sequence logo: adiA.3.LGO.gif
Sequence Alignment: adiA.3.ALGN
Solution location in genomic coordinates: 4338260-4338282 R
Solution sequence with flanking nucleotides: agtat CAGCCAAAAAAATAGTTTAGCCG tcgat
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page