adiY Gene Page
Genbank name: adiY
EcoGene name: adiY
Divergent gene:
Species with an ortholog:
EC ST
EcoGene link: EG11966
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 9.02
Model logo: adiY.1.model.LGO.gif
Sequence logo: adiY.1.LGO.gif
Sequence Alignment: adiY.1.ALGN
Solution location in genomic coordinates: 4335656-4335671 R
Solution sequence with flanking nucleotides: atcct GTAAAAAAATATGTAC atgag
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4335629-4335644 R
Solution sequence with flanking nucleotides: aatta CTATAAAAATTTGTAC tatta
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 6.52
Model logo: adiY.2.model.LGO.gif
Sequence logo: adiY.2.LGO.gif
Sequence Alignment: adiY.2.ALGN
Solution location in genomic coordinates: 4335791-4335812 R
Solution sequence with flanking nucleotides: aaggc GTAATTGTTTAAATAACATTAC gccgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4335740-4335761 R
Solution sequence with flanking nucleotides: gtatg GCAACGTTTTCATAAAAATTGC tgcaa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.99
Model logo: adiY.3.model.LGO.gif
Sequence logo: adiY.3.LGO.gif
Sequence Alignment: adiY.3.ALGN
Solution location in genomic coordinates: 4335714-4335734 R
Solution sequence with flanking nucleotides: tgcaa ACAAAAATGTCATACTTTTTG cgcgg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page