adk Gene Page

Genbank name: adk
EcoGene name: adk
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10032

Species that contributed to the solution: EC HI SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 10.81
Model logo: adk.1.model.LGO.gif
Sequence logo: adk.1.LGO.gif
Sequence Alignment: adk.1.ALGN
Solution location in genomic coordinates: 496346-496369
Solution sequence with flanking nucleotides: ggtgg TATCGTTTATCGCTTTTTCAAAAA attcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 9.92
Model logo: adk.2.model.LGO.gif
Sequence logo: adk.2.LGO.gif
Sequence Alignment: adk.2.ALGN
Solution location in genomic coordinates: 496268-496290
Solution sequence with flanking nucleotides: atcat CTGCACTTTCCGCAAATTATCTC gccat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 496353-496375
Solution sequence with flanking nucleotides: tcgtt TATCGCTTTTTCAAAAAATTCGA cacat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST TF VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 4.16
Model logo: adk.3.model.LGO.gif
Sequence logo: adk.3.LGO.gif
Sequence Alignment: adk.3.ALGN
Solution location in genomic coordinates: 496217-496237
Solution sequence with flanking nucleotides: t GATGTAATGCCGGATGACCTT cgtgt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt44     Overlap: 13
Solution location in genomic coordinates: 496238-496258
Solution sequence with flanking nucleotides: acctt CGTGTCATCCGGCATTTTTCT tttca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REPt44     Overlap: 13


Gene Index Page