aefA Gene Page

Genbank name: aefA
EcoGene name: kefA
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   YP   
EcoGene link: EG14240

Species that contributed to the solution: AA EC HI PA ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 10.27
Model logo: aefA.1.model.LGO.gif
Sequence logo: aefA.1.LGO.gif
Sequence Alignment: aefA.1.ALGN
Solution location in genomic coordinates: 485650-485670
Solution sequence with flanking nucleotides: ctcca GGATTTTTCCTGGACATTTTC gtcgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 485716-485736
Solution sequence with flanking nucleotides: ggttt GACTTTTTCAGGTCGTTCTTC aggtt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 5.98
Model logo: aefA.2.model.LGO.gif
Sequence logo: aefA.2.LGO.gif
Sequence Alignment: aefA.2.ALGN
Solution location in genomic coordinates: 485695-485713
Solution sequence with flanking nucleotides: actgc GTCGTGATATTCTTGCGGT ttgac
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 4.57
Model logo: aefA.3.model.LGO.gif
Sequence logo: aefA.3.LGO.gif
Sequence Alignment: aefA.3.ALGN
Solution location in genomic coordinates: 485740-485756
Solution sequence with flanking nucleotides: tcagg TTCAGAAACCTTCATTC atc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page