aer Gene Page
Genbank name: aer
EcoGene name: aer
Divergent gene: ygjG
Species with an ortholog:
EC PA SP ST VC YP
EcoGene link: EG12955
Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 16.47
Model logo: aer.1.model.LGO.gif
Sequence logo: aer.1.LGO.gif
Sequence Alignment: aer.1.ALGN
Solution location in genomic coordinates: 3216994-3217014 R
Solution sequence with flanking nucleotides: gcaat ATTTAATGCTATCTGTTAACA tttgt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3216789-3216809 R
Solution sequence with flanking nucleotides: atcta AATCAAATTAATCGGTTAAAG ataac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 12.14
Model logo: aer.2.model.LGO.gif
Sequence logo: aer.2.LGO.gif
Sequence Alignment: aer.2.ALGN
Solution location in genomic coordinates: 3216812-3216828 R
Solution sequence with flanking nucleotides: gttta AATCGCAAATTGCGATC taaat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 9.40
Model logo: aer.3.model.LGO.gif
Sequence logo: aer.3.LGO.gif
Sequence Alignment: aer.3.ALGN
Solution location in genomic coordinates: 3216722-3216739 R
Solution sequence with flanking nucleotides: accat ATAACCTGCACAGGACGC gaac
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page