agaR Gene Page

Genbank name: agaR
EcoGene name: agaR
Divergent gene: agaZ
Species with an ortholog: EC   YP   
EcoGene link: EG12762

Species that contributed to the solution: EC YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 6.54
Model logo: agaR.1.model.LGO.gif
Sequence logo: agaR.1.LGO.gif
Sequence Alignment: agaR.1.ALGN
Solution location in genomic coordinates: 3276510-3276530 R
Solution sequence with flanking nucleotides: tactg CGATATTAATCTTTCGTTTTG tttca
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: agaR_agaZ_IR     Overlap: 21
Solution location in genomic coordinates: 3276321-3276341 R
Solution sequence with flanking nucleotides: caaaa CGAAATGAAACGAAAGTTTTA cgaaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 3.82
Model logo: agaR.2.model.LGO.gif
Sequence logo: agaR.2.LGO.gif
Sequence Alignment: agaR.2.ALGN
Solution location in genomic coordinates: 3276457-3276480 R
Solution sequence with flanking nucleotides: gagat AAAAATAAAACGAAAGATAATGGT tttct
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: agaR_agaZ_IR     Overlap: 24

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.67
Model logo: agaR.3.model.LGO.gif
Sequence logo: agaR.3.LGO.gif
Sequence Alignment: agaR.3.ALGN
Solution location in genomic coordinates: 3276437-3276456 R
Solution sequence with flanking nucleotides: atggt TTTCTGATCTGATTCACAAA agaaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: agaR_agaZ_IR     Overlap: 20


Gene Index Page