agaS Gene Page

Genbank name: agaS
EcoGene name: agaS
Divergent gene:
Species with an ortholog: EC YP
EcoGene link: EG12767

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: -1.24
Model logo: agaS.1.model.LGO.gif
Sequence logo: agaS.1.LGO.gif
Sequence Alignment: agaS.1.ALGN
Solution location in genomic coordinates: 3279369-3279392
Solution sequence with flanking nucleotides: tctta TCCGACCTACAGTTGGTGACCGCA aggcc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP239a Overlap: 10
Repeat: REP239b Overlap: 2

Species that contributed to the solution: EC YP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: -1.58
Model logo: agaS.2.model.LGO.gif
Sequence logo: agaS.2.LGO.gif
Sequence Alignment: agaS.2.ALGN
Solution location in genomic coordinates: 3279335-3279351
Solution sequence with flanking nucleotides: tctgt GCAGCGGTGTCGGATGC gacgc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP239a Overlap: 9

Gene Index Page