agaZ Gene Page

Genbank name: agaZ
EcoGene name: agaZ
Divergent gene: agaR
Species with an ortholog: EC   YP   
EcoGene link: EG12763

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: 1.24
Model logo: agaZ.1.model.LGO.gif
Sequence logo:
Sequence Alignment: agaZ.1.ALGN
Solution location in genomic coordinates: 3276436-3276457
Solution sequence with flanking nucleotides: gtttc TTTTGTGAATCAGATCAGAAAA ccatt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: agaR_agaZ_IR     Overlap: 22


Gene Index Page