agp Gene Page
Genbank name: agp
EcoGene name: agp
Divergent gene:
Species with an ortholog:
EC ST
EcoGene link: EG10033
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 12.14
Model logo: agp.1.model.LGO.gif
Sequence logo: agp.1.LGO.gif
Sequence Alignment: agp.1.ALGN
Solution location in genomic coordinates: 1064730-1064753
Solution sequence with flanking nucleotides: agcca TTTTGCGAACCTGTTCCCGGAAAA aagtc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 5.31
Model logo: agp.2.model.LGO.gif
Sequence logo: agp.2.LGO.gif
Sequence Alignment: agp.2.ALGN
Solution location in genomic coordinates: 1064546-1064562
Solution sequence with flanking nucleotides: ttgtt ATTAGTCTCACACTTTT ttatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1064761-1064777
Solution sequence with flanking nucleotides: gtcat ATTTCTGTCACACTCTT tagtg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yccE_agp_IR3 Overlap: 16
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 2.34
Model logo: agp.3.model.LGO.gif
Sequence logo: agp.3.LGO.gif
Sequence Alignment: agp.3.ALGN
Solution location in genomic coordinates: 1064580-1064603
Solution sequence with flanking nucleotides: attgt CTCTGTATTGGTAACGCCGCAGAT attct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1064629-1064652
Solution sequence with flanking nucleotides: caatt ATCAGCGGCGTACGCGAGGCAGGG gctaa
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page