ahpC Gene Page

Genbank name: ahpC
EcoGene name: ahpC
Divergent gene: dsbG
Species with an ortholog: EC   PA   SP   ST   VC   YP   
EcoGene link: EG11384

Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 14.62
Model logo: ahpC.1.model.LGO.gif
Sequence logo: ahpC.1.LGO.gif
Sequence Alignment: ahpC.1.ALGN
Solution location in genomic coordinates: 637871-637894
Solution sequence with flanking nucleotides: cttag ATCAGGTGATTGCCCTTTGTTTAT gaggg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 638115-638138
Solution sequence with flanking nucleotides: gccga ATCGGCAAAAATTGGTTACCTTAC atctc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.90
Model logo: ahpC.2.model.LGO.gif
Sequence logo: ahpC.2.LGO.gif
Sequence Alignment: ahpC.2.ALGN
Solution location in genomic coordinates: 638090-638113
Solution sequence with flanking nucleotides: tcgat TTGATAATGGAAACGCATTAGCCG aatcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 7.46
Model logo: ahpC.3.model.LGO.gif
Sequence logo: ahpC.3.LGO.gif
Sequence Alignment: ahpC.3.ALGN
Solution location in genomic coordinates: 637903-637924
Solution sequence with flanking nucleotides: ggtgt TGTAATCCATGTCGTTGTTGCA tttgt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page