ahpF Gene Page

Repeat: IRU6     Overlap: 23
Solution location in genomic coordinates: 638814-638836
Solution sequence with flanking nucleotides: ggatt CACAGGCTAGCCGCCTTGCTCTG acgcg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU6     Overlap: 23

---

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 14.11
Model logo: ahpF.2.model.LGO.gif
Sequence logo: ahpF.2.LGO.gif
Sequence Alignment: ahpF.2.ALGN
Solution location in genomic coordinates: 638741-638756
Solution sequence with flanking nucleotides: ccttc GTCTTTCACGCCATAG cggcg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU6     Overlap: 16
Solution location in genomic coordinates: 638832-638847
Solution sequence with flanking nucleotides: ccttg CTCTGACGCGAAATAC ttcgg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU6     Overlap: 16

---

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 11.68
Model logo: ahpF.3.model.LGO.gif
Sequence logo: ahpF.3.LGO.gif
Sequence Alignment: ahpF.3.ALGN
Solution location in genomic coordinates: 638755-638772
Solution sequence with flanking nucleotides: gccat AGCGGCGTTGGCGTCGCC cgctc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU6     Overlap: 18
Solution location in genomic coordinates: 638913-638930
Solution sequence with flanking nucleotides: atgca AGCTGCATCCAGGTAGCC gcaga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU6_ahpF_IR1     Overlap: 18


Gene Index Page