aidB Gene Page

Genbank name: aidB
EcoGene name: aidB
Divergent gene:
Species with an ortholog: EC   PA   ST   YP
EcoGene link: EG11811    Reported site,genomic coordinates and site type: DPInteract 4411760:4411790 ada
   Reported site,genomic coordinates and site type: RegulonDB 4411765:4411789 ada

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 4.00
Model logo: aidB.1.model.LGO.gif
Sequence logo: aidB.1.LGO.gif
Sequence Alignment: aidB.1.ALGN
Solution location in genomic coordinates: 4411768-4411787
Solution sequence with flanking nucleotides: t AAGAATGTTTTAGCAATCTC tttct
Number of overlapping basepairs with reported site: 20
Site type: ada

Species that contributed to the solution: EC
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 2
Map value: 3.97
Model logo: aidB.2.model.LGO.gif
Sequence logo: aidB.2.LGO.gif
Sequence Alignment: aidB.2.ALGN
Solution location in genomic coordinates: 4411803-4411818
Solution sequence with flanking nucleotides: gaatc CATGGCAGTGACCATA ctaat
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yjfC_aidB_IR Overlap: 16
Solution location in genomic coordinates: 4411821-4411836
Solution sequence with flanking nucleotides: atact AATGGTGACTGCCATT g
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yjfC_aidB_IR Overlap: 16

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.39
Model logo: aidB.3.model.LGO.gif
Sequence logo: aidB.3.LGO.gif
Sequence Alignment: aidB.3.ALGN
Solution location in genomic coordinates: 4411811-4411828
Solution sequence with flanking nucleotides: ggcag TGACCATACTAATGGTGA ctgcc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yjfC_aidB_IR Overlap: 18

Gene Index Page