ais Gene Page

Genbank name: ais
EcoGene name: ais
Divergent gene: yfbE
Species with an ortholog: EC ST
EcoGene link: EG13155

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 8.88
Model logo: ais.1.model.LGO.gif
Sequence logo: ais.1.LGO.gif
Sequence Alignment: ais.1.ALGN
Solution location in genomic coordinates: 2363820-2363843 R
Solution sequence with flanking nucleotides: ttaac TTAACCTTAAGAAACTAATATTAG acgta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ais_yfbE_IR Overlap: 10

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 6.19
Model logo: ais.2.model.LGO.gif
Sequence logo: ais.2.LGO.gif
Sequence Alignment: ais.2.ALGN
Solution location in genomic coordinates: 2363670-2363693 R
Solution sequence with flanking nucleotides: aatgt AGCTCAATTTCACGGTAATTGTCT ggttg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 5.43
Model logo: ais.3.model.LGO.gif
Sequence logo: ais.3.LGO.gif
Sequence Alignment: ais.3.ALGN
Solution location in genomic coordinates: 2363846-2363867 R
Solution sequence with flanking nucleotides: gagcg AAATTTTAAGGATAGAATATTA actta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2363794-2363815 R
Solution sequence with flanking nucleotides: gacgt AAATATTGAAATTTTTATATTT tttct
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ais_yfbE_IR Overlap: 22

Gene Index Page