alaS Gene Page

Genbank name: alaS
EcoGene name: alaS
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10034

Species that contributed to the solution: EC HI ST TF YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 20.35
Model logo: alaS.1.model.LGO.gif
Sequence logo: alaS.1.LGO.gif
Sequence Alignment: alaS.1.ALGN
Solution location in genomic coordinates: 2820117-2820135 R
Solution sequence with flanking nucleotides: cccag TCAAGAAAACTTATCTTAT tccca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA ST TF VC YP
Total number of sites in the solution: 12
Number of E. coli sites in the solution: 2
Map value: 15.95
Model logo: alaS.2.model.LGO.gif
Sequence logo: alaS.2.LGO.gif
Sequence Alignment: alaS.2.ALGN
Solution location in genomic coordinates: 2820127-2820148 R
Solution sequence with flanking nucleotides: ggtat TTTACCTTCCCAGTCAAGAAAA cttat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2820035-2820056 R
Solution sequence with flanking nucleotides: atttc GTTAGCTTGATTTCAGGATAAT t
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI PA SP ST TF
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 10.78
Model logo: alaS.3.model.LGO.gif
Sequence logo: alaS.3.LGO.gif
Sequence Alignment: alaS.3.ALGN
Solution location in genomic coordinates: 2820096-2820112 R
Solution sequence with flanking nucleotides: ttccc ACTTTTCAGTTACCAGC ccggc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page