aldB Gene Page

Genbank name: aldB
EcoGene name: aldB
Divergent gene:
Species with an ortholog: EC   SP   ST
EcoGene link: EG12292    Reported site,genomic coordinates and site type: DPInteract 3754214:3754235 crp
   Reported site,genomic coordinates and site type: PMID:7768815/RegulonDB 3754264:3754331 fis
   Reported site,genomic coordinates and site type: PMID:7768815/RegulonDB 3754182:3754228 fis

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 6.03
Model logo: aldB.1.model.LGO.gif
Sequence logo: aldB.1.LGO.gif
Sequence Alignment: aldB.1.ALGN
Solution location in genomic coordinates: 3754274-3754297 R
Solution sequence with flanking nucleotides: tcatt TCCACAACGGCTGGCAAATTGTTA gccgc
Number of overlapping basepairs with reported site: 24
Site type: fis

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 2.34
Model logo: aldB.2.model.LGO.gif
Sequence logo: aldB.2.LGO.gif
Sequence Alignment: aldB.2.ALGN
Solution location in genomic coordinates: 3754232-3754249 R
Solution sequence with flanking nucleotides: ctgta ACCCTTGCCCGTAAATTC
Number of overlapping basepairs with reported site: 4
Site type: crp

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 0.94
Model logo: aldB.3.model.LGO.gif
Sequence logo: aldB.3.LGO.gif
Sequence Alignment: aldB.3.ALGN
Solution location in genomic coordinates: 3754277-3754294 R
Solution sequence with flanking nucleotides: tttcc ACAACGGCTGGCAAATTG ttagc
Number of overlapping basepairs with reported site: 18
Site type: fis
Solution location in genomic coordinates: 3754232-3754249 R
Solution sequence with flanking nucleotides: ctgta ACCCTTGCCCGTAAATTC
Number of overlapping basepairs with reported site: 4
Site type: crp

Gene Index Page