aldH Gene Page
Genbank name: aldH
EcoGene name: aldH
Divergent gene:
Species with an ortholog:
EC PA SP
EcoGene link: EG10036
Species that contributed to the solution: EC PA SP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 4.26
Model logo: aldH.1.model.LGO.gif
Sequence logo: aldH.1.LGO.gif
Sequence Alignment: aldH.1.ALGN
Solution location in genomic coordinates: 1360534-1360549
Solution sequence with flanking nucleotides: ccggc AATCTATACACAAAAT cattc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU9     Overlap: 10
Solution location in genomic coordinates: 1360657-1360672
Solution sequence with flanking nucleotides: gatga AGTGTATATAAAGAAT gtcgc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU9     Overlap: 10
Species that contributed to the solution: EC PA
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 0.53
Model logo: aldH.2.model.LGO.gif
Sequence logo: aldH.2.LGO.gif
Sequence Alignment: aldH.2.ALGN
Solution location in genomic coordinates: 1360687-1360703
Solution sequence with flanking nucleotides: aataa ACGGGCATACGGCCCGG ggatc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: -0.01
Model logo: aldH.3.model.LGO.gif
Sequence logo: aldH.3.LGO.gif
Sequence Alignment: aldH.3.ALGN
Solution location in genomic coordinates: 1360626-1360645
Solution sequence with flanking nucleotides: cgaac GCAGCCAAGGCAGAGGCGGC ttgaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: IRU9     Overlap: 20
Gene Index Page