alkA Gene Page

Genbank name: alkA
EcoGene name: alkA
Divergent gene: yegD
Species with an ortholog: EC   PA   SP   ST   TF   VC
EcoGene link: EG11222    Reported site,genomic coordinates and site type: DPInteract 2145609:2145639 ada
   Reported site,genomic coordinates and site type: RegulonDB 2145603:2145630 ada

Species that contributed to the solution: EC SP ST TF VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 10.08
Model logo: alkA.1.model.LGO.gif
Sequence logo: alkA.1.LGO.gif
Sequence Alignment: alkA.1.ALGN
Solution location in genomic coordinates: 2145611-2145630 R
Solution sequence with flanking nucleotides: cc GGAATATGAAAGCAAAGCGC agcgt
Number of overlapping basepairs with reported site: 20
Site type: ada ada

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 8.80
Model logo: alkA.2.model.LGO.gif
Sequence logo: alkA.2.LGO.gif
Sequence Alignment: alkA.2.ALGN
Solution location in genomic coordinates: 2145585-2145607 R
Solution sequence with flanking nucleotides: gcagc GTCTGAATAACGTTTATGCTGAA agcgg
Number of overlapping basepairs with reported site: 5
Site type: ada

Species that contributed to the solution: EC SP TF VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 4.42
Model logo: alkA.3.model.LGO.gif
Sequence logo: alkA.3.LGO.gif
Sequence Alignment: alkA.3.ALGN
Solution location in genomic coordinates: 2145566-2145584 R
Solution sequence with flanking nucleotides: ctgaa AGCGGATGAATAAGGAGAT gcg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page