alr Gene Page
Genbank name: alr
EcoGene name: alr
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST YP
EcoGene link: EG10001
Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 11.43
Model logo: alr.1.model.LGO.gif
Sequence logo: alr.1.LGO.gif
Sequence Alignment: alr.1.ALGN
Solution location in genomic coordinates: 4263306-4263324
Solution sequence with flanking nucleotides: TAATAATTATTTTATGAAT taggt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4263339-4263357
Solution sequence with flanking nucleotides: aaagc AAACACTTATCAAGGAACA caa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 9.78
Model logo: alr.2.model.LGO.gif
Sequence logo: alr.2.LGO.gif
Sequence Alignment: alr.2.ALGN
Solution location in genomic coordinates: 4263319-4263340
Solution sequence with flanking nucleotides: atttt ATGAATTAGGTAATTAAAGCAA acact
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page