amiA Gene Page
Genbank name: amiA
EcoGene name: amiA
Divergent gene: ypeA
Species with an ortholog:
EC ST
EcoGene link: EG11823
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 13.13
Model logo: amiA.1.model.LGO.gif
Sequence logo: amiA.1.LGO.gif
Sequence Alignment: amiA.1.ALGN
Solution location in genomic coordinates: 2550271-2550290
Solution sequence with flanking nucleotides: c TATTGAAATGAAAAGTAAAA caatt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2550341-2550360
Solution sequence with flanking nucleotides: taaca TCTGGAACTTTATTATTACA actca
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 12.09
Model logo: amiA.2.model.LGO.gif
Sequence logo: amiA.2.LGO.gif
Sequence Alignment: amiA.2.ALGN
Solution location in genomic coordinates: 2550306-2550321
Solution sequence with flanking nucleotides: cagca AACCGTCGTAACGGAT tacgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2550328-2550343
Solution sequence with flanking nucleotides: acgcg ATACGATATAACATCT ggaac
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 11.83
Model logo: amiA.3.model.LGO.gif
Sequence logo: amiA.3.LGO.gif
Sequence Alignment: amiA.3.ALGN
Solution location in genomic coordinates: 2550311-2550333
Solution sequence with flanking nucleotides: aaccg TCGTAACGGATTACGCGATACGA tataa
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page