ampC Gene Page

Genbank name: ampC
EcoGene name: ampC
Divergent gene:
Species with an ortholog: EC PA SP
EcoGene link: EG10040

Species that contributed to the solution: EC PA
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 2.82
Model logo: ampC.1.model.LGO.gif
Sequence logo: ampC.1.LGO.gif
Sequence Alignment: ampC.1.ALGN
Solution location in genomic coordinates: 4376545-4376566 R
Solution sequence with flanking nucleotides: taaat CCGGCCCGCCTATGGCGGGCCG ttttg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ampC_frdD_IR Overlap: 22

Species that contributed to the solution: EC
Total number of sites in the solution: 1
Number of E. coli sites in the solution: 1
Map value: -0.00
Model logo: ampC.2.model.LGO.gif
Sequence logo:
Sequence Alignment: ampC.2.ALGN
Solution location in genomic coordinates: 4376525-4376541 R
Solution sequence with flanking nucleotides: cgttt TGTATGGAAACCAGACC ct
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ampC_frdD_IR Overlap: 1

Species that contributed to the solution: EC SP
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: -0.75
Model logo: ampC.3.model.LGO.gif
Sequence logo: ampC.3.LGO.gif
Sequence Alignment: ampC.3.ALGN
Solution location in genomic coordinates: 4376569-4376587 R
Solution sequence with flanking nucleotides: TAACGCATCGCCAATGTAA atccg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: ampC_frdD_IR Overlap: 1

Gene Index Page