ampD Gene Page
Genbank name: ampD
EcoGene name: ampD
Divergent gene: nadC
Species with an ortholog:
EC HI PA SP ST TF VC YP
EcoGene link: EG10041
Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 16.82
Model logo: ampD.1.model.LGO.gif
Sequence logo: ampD.1.LGO.gif
Sequence Alignment: ampD.1.ALGN
Solution location in genomic coordinates: 118675-118698
Solution sequence with flanking nucleotides: atcat AAGGTAGAAACATGCTACTCTGAA ccggg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 10.33
Model logo: ampD.2.model.LGO.gif
Sequence logo: ampD.2.LGO.gif
Sequence Alignment: ampD.2.ALGN
Solution location in genomic coordinates: 118652-118671
Solution sequence with flanking nucleotides: ttaaa ACTCCAGATAGCTAACGAAT cataa
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 9.89
Model logo: ampD.3.model.LGO.gif
Sequence logo: ampD.3.LGO.gif
Sequence Alignment: ampD.3.ALGN
Solution location in genomic coordinates: 118702-118722
Solution sequence with flanking nucleotides: aaccg GGTATTAGCACCACATATAAG gagat
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page